BBa_K1833009 1 BBa_K1833009 T7 promoter -> 434 cI N terminus with P22 repressor specificity 2015-09-17T11:00:00Z 2015-09-17T11:13:57Z "A two-hybrid system based on chimeric operator recognition for studying protein homo/heterodimerization in Escherichia coli" (G. Di Lallo, L. Castagnoli, P. Ghelardini and L. Paolozzi; Microbiology (2001), 147, 1651???1656) described the use of this protein domain. This part produces the DNA binding domain of the phage 434 cI repressor, with mutations that change the specificity of the DNA to which the protein binds. This protein domain was used as in "A two-hybrid system based on chimeric operator recognition for studying protein homo/heterodimerization in Escherichia coli" (G. Di Lallo, L. Castagnoli, P. Ghelardini and L. Paolozzi; Microbiology (2001), 147, 1651???1656). For more information on the uses of this part, visit 2015.igem.org/Team:Pitt/Protease/Project. false false _2259_ 27388 27388 9 false This part was designed with a T7 promoter so the protein could be overexpressed. false Konstantin Borisov annotation2469005 1 rbs range2469005 1 24 29 annotation2469007 1 P22-like 434 cI N-terminus range2469007 1 33 317 annotation2469004 1 pT7 range2469004 1 1 20 annotation2469011 1 T7 terminator range2469011 1 318 358 BBa_K1833009_sequence 1 taatacgactcactatagggaaagaggagaaaatgagtatcagctcgcgtgtgaaaagtaaacgcatccagctgggactgaatcaggccgagctggcgcagaaagttggtacgagtaacgtgtctatttcccagctggaacgcggaaaaaccaaacgcccgcgtttcctgcctgaactggcaagcgccttgggcgtgtctgtagactggcttttaaacggcacttctgattcgaatgttcgctttgtcggccatgtggagccgaaaggcaaatacccactgattagcatggtacgcgccggtagctggtgctgataaaaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z