BBa_K1833011 1 BBa_K1833011 lac promoter -> Zinc finger 225 binding domain fused to immunogenic MUC1 peptide 2015-09-17T11:00:00Z 2015-09-18T12:13:30Z Uniprot This part generates a fusion protein containing the zinc finger 225 DNA binding domain and two repeats of the MUC1 immunogenic peptide. For more information on the use of this part, visit <html><a href="http://2015.igem.org/Team:Pitt/3-hybrid/Project">the 2015 Pitt iGEM page.</a></html> false false _2259_ 27388 27388 9 false thinks false Konstantin Borisov annotation2469592 1 linker range2469592 1 248 256 annotation2469572 1 lacI binding site range2469572 1 37 57 annotation2469598 1 terminator range2469598 1 545 632 annotation2469593 1 Zif268 binding domain range2469593 1 257 538 annotation2469574 1 start range2469574 1 125 127 annotation2469597 1 stop range2469597 1 539 544 annotation2469573 1 rbs range2469573 1 112 119 annotation2469582 1 MUC1 immunogenic peptide (x2) range2469582 1 128 247 annotation2469571 1 pLac range2469571 1 1 93 BBa_K1833011_sequence 1 tttacactttatgcttccggctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggaactcgagaccaaagagaggacacaatggctccggacacccggccagcgccgggcagcaccgctcctccggcacacggtgtgacaagcgcgccggatacccgcccagccccgggatctacagcacctccagcccacggtgtgacgagtgcagcagcgccctccaagacgccgccgcacgaacgtccatacgcctgcccggtcgaaagttgtgatcgtcggtttagtcgttccgatgagcttacccgtcacatccgtattcatacaggccagaaaccgttccagtgccgtatttgcatgcgcaacttttcgcgcagtgaccatttaactactcacatccgcacgcatacgggcgagaagccgttcgcctgcgacatttgtggccgcaagttcgcgcgcagcgacgaacgcaagcgtcacaccaaaatccacctgcggcagtaatagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z