BBa_K1833997 1 BBa_K1833997 T3 promoter as annealed oligonucleotides 2015-09-15T11:00:00Z 2015-09-16T07:59:14Z Synthesized oligonucleotides as described on main page. This is a part used as a building block for T3 driven expression. However, this part uses a special cloning method with the following synthesized nucleotides: pT3sense: aattcgcggccgcttctagaaattaaccctcactaaagggagaa pT3antisense: ctagttctccctttagtgagggttaatttctagaagcggccgcg The following method can be used to insert pProt before a desired Biobrick part (which should contain an RBS at minimum and preferably a cds and terminator): 1. Cut the desired plasmid with EcoRI and XbaI. Purify the plasmid with a method of your choice (both gel purification and PCR purification kits from Qiagen serve to remove the short undesired oligonucleotide from the digestion). 2. Be sure that your oligos have 5' phosphorylation (treat unphosphorylated oligos with T4 Polynucleotide Kinase). Then, anneal the two oligos by slowly cooling from 98C to room temperature. 3. Finally, ligate the cut plasmid with the annealed oligos by using a 1:10 molar ratio of plasmid to insert. 4. Transform the ligation reaction into E. coli, and plate. 5. Pick colonies, and verify the success of the cloning with sequencing or PCR. (Doing a diagnostic digest is not recommended as the size of the original plasmid and the desired plasmid are very similar.) 6. Add a composite part to the iGEM registry by using this part with the original protein coding part, <I>checking the box to create without a scar,</I> as this part contains a modified scar. false false _2259_ 27388 27388 9 false When ligating with a cut plasmid, this leaves a modified Biobrick scar between the T7 promoter and original Biobrick part, which is included in the sequence of this part. false Konstantin Borisov annotation2460295 1 Oligo scar range2460295 1 24 29 annotation2460294 1 pT3 range2460294 1 1 23 BBa_K1833997_sequence 1 aattaaccctcactaaagggagaactaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z