BBa_K1835500 1 BBa_K1835500 Phi X 147 E Lysis Gene 2015-09-16T11:00:00Z 2015-09-18T07:05:58Z Phi X 147 Bacteriophage Bacteriophage's lysis gene that inhibits the creation of new cell wall after cell division. false false _2261_ 26097 26097 9 false Synthesized de novo and slightly toxic when expressed, even when uninduced. false Anthony Ciesla BBa_K1835500_sequence 1 atggtacgctggactttgtgggataccctcgctttcctgctcctgttgagtttattgctgccgtcattgcttattatgttcatcccgtcaacattcaaacggcctgtctcatcatggaaggcgctgaatttacggaaaacattattaatggcgtcgagcgtccggttaaagccgctgaattgttcgcgtttaccttgcgtgtacgcgcaggaaacactgacgttcttactgacgcagaagaaaacgtgcgtcaaaaattacgtgcggaaggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z