BBa_K1838000 1 BBa_K1838000 Glucose Sensitive Promoter via MLC E. coli interactions 2015-09-17T11:00:00Z 2015-09-25T09:47:59Z 1. Plumbridge, Jacqueline. ???DNA Binding Sites for the MLC and NagC Proteins: Regulation of nagE, Encoding the N-Acetylglucosamine-Specific Transporter inEscherichia Coli.??? Nucleic Acids Research 29.2 (2001): 506???514. Print. 2. http://parts.igem.org/Part:BBa_J23119 This part contains the palindromic binding site for the protein MLC encoded by the gene dgsA, a gene native to E. coli. Specifically, MLC is a repressor regulator for many phosphoenolpyruvate-dependent carbohydrate phosphotransferase systems (PTSs). In this part, the binding site is found upstream of the base promoter used for construction, BBa_J23119. false false _2264_ 26050 26050 9 false One issue to consider was where to place the MLC binding site and what strength promoter to use as a base. This was solved by creating multiple variants of the promorer (MLC1-4). false Connor McFadden annotation2473448 1 BBa_J23119 range2473448 1 24 58 annotation2473433 1 MLC Binding Site range2473433 1 1 23 BBa_K1838000_sequence 1 ttattttactctgtgtaataaatttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z