BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1033931 1 BBa_K1033931 amilGFP, yellow chromoprotein (incl RBS) 2013-09-16T11:00:00Z 2015-05-08T01:08:50Z Acropora millepora. The DNA was provided by Jeffrey Miller at UCLA, and was made BioBrick-compatible by removing two illegal internal restriction sites (EcoRI and PstI). This chromoprotein from the coral Acropora millepora, amilGFP, naturally exhibits strong yellow color when expressed. The color is readily visible to naked eye both in LB-culture and on agar plates. Color development can be seen in less than 24 hours of incubation. false false _1340_ 0 13997 9 In stock false Two illegal internal restriction sites (EcoRI and PstI) were removed. false Erik Lundin component2351898 1 BBa_K592010 component2351896 1 BBa_B0034 annotation2351898 1 BBa_K592010 range2351898 1 19 717 annotation2351896 1 BBa_B0034 range2351896 1 1 12 BBa_K1838006 1 BBa_K1838006 MLC Glucose Sensitive Yellow Chromoprotein Construct 2015-09-17T11:00:00Z 2016-01-21T02:20:22Z 1. Plumbridge, Jacqueline. ???DNA Binding Sites for the MLC and NagC Proteins: Regulation of nagE, Encoding the N-Acetylglucosamine-Specific Transporter inEscherichia Coli.??? Nucleic Acids Research 29.2 (2001): 506???514. Print. 2. http://parts.igem.org/Part:BBa_J23110 3. http://parts.igem.org/Part:BBa_K1033931 This composite part features our MLC2 construct combined via 3A assembly with a yellow chromoprotein+RBS part (BBa_K1033931). During transcription, the MLC2 binding site is bound by the protein MLC, inhibiting production of yellow chromoprotein. As glucose concentration increases in the cell, more MLC is uptaken and bound to the membrane by a mechanism involving the transmembrane glucose permease called IICBGlu. This means that higher glucose concentrations subsequently result in higher expression levels of the yellow chromoprotein and thus makes it a glucose-inducible chromoprotein producing part. Specifically, this part tests the hypothesis for how MLC affects the inducibility of an average strength promoter when placed upstream of the base promoter sequence. false false _2264_ 4206 26050 9 false One issue to consider was where to place the MLC binding site and what strength promoter to use as a base. This was solved by creating multiple variants of the promorer (MLC1-4). This part may be improved by considering how the RBS is affected by the position of the MLC binding site. false Connor McFadden component2473522 1 BBa_K1838002 component2473527 1 BBa_K1033931 annotation2473522 1 BBa_K1838002 range2473522 1 1 58 annotation2473527 1 BBa_K1033931 range2473527 1 67 783 BBa_K592010 1 amilGFP amilGFP, yellow chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:48Z Acropora millepora This chromoprotein, amilGFP, naturally exhibits very strong yellow color when expressed. The color is strong and readily visible to naked eye both in LB-culture and on agar plates. The DNA was provided by Jeffrey Miller at UCLA. It was made BioBrick-compatible after removal of two illegal internal restriction sites (EcoRI and PstI). false false _763_ 0 7929 9 It's complicated false Two illegal internal restriction sites (EcoRI and PstI) was removed. false Lei Sun annotation2131633 1 amilGFP range2131633 1 1 696 BBa_K1838002 1 BBa_K1838002 Glucose Sensitive Promoter via MLC E. coli interactions 2015-09-17T11:00:00Z 2015-09-25T09:49:09Z 1. Plumbridge, Jacqueline. ???DNA Binding Sites for the MLC and NagC Proteins: Regulation of nagE, Encoding the N-Acetylglucosamine-Specific Transporter inEscherichia Coli.??? Nucleic Acids Research 29.2 (2001): 506???514. Print. 2. http://parts.igem.org/Part:BBa_J23110 This part contains the palindromic binding site for the protein MLC encoded by the gene dgsA, a gene native to E. coli. Specifically, MLC is a repressor regulator for many phosphoenolpyruvate-dependent carbohydrate phosphotransferase systems (PTSs). In this part, the binding site is found upstream of the base promoter used for construction, BBa_J23119. false false _2264_ 26050 26050 9 false One issue to consider was where to place the MLC binding site and what strength promoter to use as a base. This was solved by creating multiple variants of the promorer (MLC1-4). false Connor McFadden annotation2473457 1 MLC Binding Site range2473457 1 1 23 annotation2473458 1 BBa_J23110 range2473458 1 24 58 BBa_K1838002_sequence 1 ttattttactctgtgtaataaatctgacagctagctcagtcctaggtataatgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1838006_sequence 1 ttattttactctgtgtaataaatctgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaatactagatgtcttattcaaagcatggcatcgtacaagaaatgaagacgaaataccatatggaaggcagtgtcaatggccatgaatttacgatcgaaggtgtaggaactgggtacccttacgaagggaaacagatgtccgaattagtgatcatcaagcctgcgggaaaaccccttccattctcctttgacatactgtcatcagtctttcaatatggaaaccgttgcttcacaaagtacccggcagacatgcctgactatttcaagcaagcattcccagatggaatgtcatatgaaaggtcatttctatttgaggatggagcagttgctacagccagctggaacattcgtctcgaaggaaattgcttcatccacaaatccatctttcatggcgtaaactttcccgctgatggacccgtaatgaaaaagaagacaattgactgggataagtccttcgaaaaaatgactgtgtctaaagaggtgctaagaggtgacgtgactatgtttcttatgctcgaaggaggtggttctcacagatgccaatttcactccacttacaaaacagagaagccggtcacactgcccccgaatcatgtcgtagaacatcaaattgtgaggaccgaccttggccaaagtgcaaaaggctttacagtcaagctggaagcacatgccgcggctcatgttaaccctttgaaggttaaataataa BBa_K592010_sequence 1 atgtcttattcaaagcatggcatcgtacaagaaatgaagacgaaataccatatggaaggcagtgtcaatggccatgaatttacgatcgaaggtgtaggaactgggtacccttacgaagggaaacagatgtccgaattagtgatcatcaagcctgcgggaaaaccccttccattctcctttgacatactgtcatcagtctttcaatatggaaaccgttgcttcacaaagtacccggcagacatgcctgactatttcaagcaagcattcccagatggaatgtcatatgaaaggtcatttctatttgaggatggagcagttgctacagccagctggaacattcgtctcgaaggaaattgcttcatccacaaatccatctttcatggcgtaaactttcccgctgatggacccgtaatgaaaaagaagacaattgactgggataagtccttcgaaaaaatgactgtgtctaaagaggtgctaagaggtgacgtgactatgtttcttatgctcgaaggaggtggttctcacagatgccaatttcactccacttacaaaacagagaagccggtcacactgcccccgaatcatgtcgtagaacatcaaattgtgaggaccgaccttggccaaagtgcaaaaggctttacagtcaagctggaagcacatgccgcggctcatgttaaccctttgaaggttaaataataa BBa_K1033931_sequence 1 aaagaggagaaatactagatgtcttattcaaagcatggcatcgtacaagaaatgaagacgaaataccatatggaaggcagtgtcaatggccatgaatttacgatcgaaggtgtaggaactgggtacccttacgaagggaaacagatgtccgaattagtgatcatcaagcctgcgggaaaaccccttccattctcctttgacatactgtcatcagtctttcaatatggaaaccgttgcttcacaaagtacccggcagacatgcctgactatttcaagcaagcattcccagatggaatgtcatatgaaaggtcatttctatttgaggatggagcagttgctacagccagctggaacattcgtctcgaaggaaattgcttcatccacaaatccatctttcatggcgtaaactttcccgctgatggacccgtaatgaaaaagaagacaattgactgggataagtccttcgaaaaaatgactgtgtctaaagaggtgctaagaggtgacgtgactatgtttcttatgctcgaaggaggtggttctcacagatgccaatttcactccacttacaaaacagagaagccggtcacactgcccccgaatcatgtcgtagaacatcaaattgtgaggaccgaccttggccaaagtgcaaaaggctttacagtcaagctggaagcacatgccgcggctcatgttaaccctttgaaggttaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z