BBa_K1839001 1 BBa_K1839001 Ava_3857 O-methyltransferase (O-MT) 2015-09-17T11:00:00Z 2015-09-18T08:35:21Z Table S1 in [Balskus and Walsh, 2010] contains the gene locus tags and protein accession numbers for the genes in the shinorine biosynthesis gene cluster. Table S4 contains the PCR primers used for cloning the gene cluster. Ava_3857 corresponds to protein accession number ABA23462.1. The exact DNA sequence can be found in the genome sequence here: http://www.ncbi.nlm.nih.gov/nuccore/75699950?from=4803114&to=4803953&sat=4&sat_key=105749970&report=gbwithparts Note that the DNA sequence reported by that link is the reverse complement, since the gene is on the opposite strand in the genome sequence! Essential references: * Balskus EP, Walsh CT. The genetic and molecular basis for sunscreen biosynthesis in cyanobacteria. Science. 2010 Sep 24;329(5999):1653-6. http://www.ncbi.nlm.nih.gov/pmc/articles/pmid/20813918/ * Gao Q, Garcia-Pichel F. An ATP-grasp ligase involved in the last biosynthetic step of the iminomycosporine shinorine in Nostoc punctiforme ATCC 29133. J Bacteriol. 2011 Nov;193(21):5923-8. http://www.ncbi.nlm.nih.gov/pmc/articles/pmid/21890703/ Anabaena variabilis ATCC 29413 contains a 4-gene cluster Ava_3858 to Ava_3855 that codes for a biosynthetic pathway producing the mycosporine-like amino acid (MAA) shinorine. Genes Ava_3858 and Ava_3857 encode demethyl 4-deoxygadusol (DDG) synthase and O-methyltransferase (O-MT), respectively, which transform sedoheptulose-7-phosphate (SHP) from the Calvin-Benson-Bassham cycle into 4-deoxygadusol (4-DG), the core structure of mycosporines. false false _2265_ 11141 11141 9 false This part uses the native cyanobacterial DNA sequence from Anabaena variabilis, with two small but important changes: 1. We removed an XbaI restriction site by by making a synonymous single-nucleotide change: TCTAGA -> TTTAGA. 2. We accidentally forgot to include the stop codon in our design. Luckily the BioBrick suffix does include an in-frame TAG stop codon, but if you express the gene directly from this biobrick, you can expect an extra tyrosine at the C terminal of the protein. false Patrik D annotation2475190 1 TTG start codon range2475190 1 1 3 annotation2475191 1 Ava_3857 coding region range2475191 1 1 837 BBa_K1839001_sequence 1 ttgacaaatgtgattgtccaaccaacagctagacctgttacaccattgggaattttaaccaagcagttagaagccatagtccaagaggttaagcaacatccagatttacctggggaattgatagcaaacatccatcaggcttggcgtttagccgcaggtatagacccttatttggaagaatgcaccactccagaatctcctgaactcgctgcattggcaaaaaccacagccaccgaagcctggggagaacacttccacggaggtacaaccgtccgtcctttagaacaagagatgctttctggtcatatcgaaggacaaaccttaaagatgtttgttcacatgaccaaagctaaaaaagtcttagaaattgggatgtttaccggttattcggcgctggcgatggcggaagcattaccagaggatggactgcttgtggcttgtgaagttgacccttacgcggcggaaattggacagaaagcctttcaacaatctccccacggtggaaagattcgtgtggaattggatgcagccttagcaactcttgataagttagcagaagctggggagtcttttgacttggtatttatcgacgcagataaaaaagagtatgtagcctattttcacaagttgctaggtagcagtttgttagcaccagatggctttatttgtgtagataacaccttattacaaggggaagtttatctaccagcagaggaacgtagcgtcaatggtgaagcgatcgcgcaatttaatcatacagtagctatagacccccgtgtagaacaggttttgttgccgttgcgagatggtttaacaattatccgcagaatacaacct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z