BBa_K1840002 1 BBa_K1840002 Zwf promotor from Pseudomonas putida 2015-09-17T11:00:00Z 2015-09-18T01:47:02Z The part was designed after information from the paper by DADDAOUA, A., KRELL, T. & RAMOS, J.-L. 2009. Regulation of Glucose Metabolism in Pseudomonas: The Phosphorylative Branch and Entner-Doudoroff Enzymes are Regulated by a Repressor Containing a Sugar Iisomerase Domain. Journal of Biological Chemistry, 284, 21360-21368. This basic part is the promotor in front of the gene for zwf (glucose 6-phosphate dehydrogenase) in Pseudomonas putida. Zwf is concerned with the glucose metabolism in P. putida. The zwf promotor is negatively regulated by the repressor called HexR. It has a binding site for glucose derivative 2-keto-3-deoxy-6-phosphogluconate (KDPG) and binding leads to the release from the promotor. For our project (NTNU Trondheim 2015) we integrated the promotor in front of the mCherry gene. Hence we built a glucose detection device, that expresses mCherry according to the glucose (and therefore KDPG) level in the environment. Note: The promotor edd (BBa_K1840000) is repressed by the same repressor HexR. See biobrick parts BBa_K1840001 and BBa_K1840003 for other promotors on operons regulated by glucose derivatives. false false _2266_ 26543 26543 9 false The considerations we made regarded the starting and endpoint of the promotor. We only know that it has to be in front of the zwf gene. We assumed it starts directly after the previous gene. This gene codes for the repressor, HexR, and is situated on the opposite strand. false Julia Anna Adrian BBa_K1840002_sequence 1 gggtgtgtccttgggtcgggaagacagccggctgtgtgagcagcaggctttttgcacggtcgtctatcgtactgtcggtgcggttgacgtaccacttgtctgtaacacttgtgtgtaatgttgtggtttttactacattatcccttgaaaaccgtgtgtgaaagcggtattcctagaccaactttaggaaagaaccaacatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z