BBa_K1840003 1 BBa_K1840003 Gad promotor from Pseudomonas 2015-09-17T11:00:00Z 2015-09-18T01:53:30Z This part was designed after information from the paper by DADDAOUA, A., KRELL, T., ALFONSO, C., MOREL, B. & RAMOS, J.-L. 2010. Compartmentalized Glucose Metabolism in Pseudomonas putida Is Controlled by the PtxS Repressor. Journal of Bacteriology, 192, 4357-4366. This basic part is the promotor in front of the gene for gad (gluconate dehydrogenase) in Pseudomonas putida. Gad is concerned with the glucose metabolism in P. putida. The gad promotor is negatively regulated by the repressor called PtxS. The glucose derivative 2-Ketogluconate can bind to it and this leads to subsequent release of PtxS from the promotor. For our project (NTNU Trondheim 2015) we integrated the promotor in front of the mCherry gene. Hence we built a glucose detection device, that expresses mCherry according to the glucose (and therefore 2-Ketogluconate) level in the environment (see BBa_K1840008). Note: The promotor kgu (BBa_K1840001) is repressed by the same repressor PtxS. See biobrick parts BBa_K1840000 and BBa_K1840002 for other promotors on operons regulated by glucose derivatives. false false _2266_ 26543 26543 9 false The considerations we made regarded the starting and endpoint of the promotor. We only know that it has to be in front of the gad gene. We assumed it starts directly after the previous gene, which is encoded on the opposite strand. false Julia Anna Adrian BBa_K1840003_sequence 1 ccttgatcctcgtctcttggcaggtcaaacactcgcagtgcacctacttccatgcggccgggcgcaagcatttgcgaaagtttgaagcctaacgaggaatcaatttttgagacagattgaaacttcctaatgcgttgtaagaagtttcgctaaaagttgtttttaagtgtttcttgtcaaaaaaatgatgttttgtacaggtagggaaggcaaagcatgaaaccggtttcaaaacctttctgaacgcgctagattattcggctgtctcttgatggcctatcaagatcacctctcaattgaaaatcagatggcgcttatcaaggccgccccacagccgatgaggattcgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z