BBa_K184001 1 BBa_K184001 Silintaphin-1 + gs linker partB 2009-10-13T11:00:00Z 2015-05-08T01:11:06Z Silintaphin-1 was created by synthetic gene synthesis with silent mutations to delete biobrick cloning sites in the endogeneous gene sequence. The gene was also codon optimised for human and e.coli expression. The Silintaphin-1 gene was derived from the silicanaceous sponge, Suberites domuncula. Silicanization protein Silintaphin-1. false false _285_ 0 3648 285 Not in stock false Synthetic gene assembly of Silintaphin-1 was created by splitting the Silintaphin-1 gene into (2) separate parts because of high GC content and repeat sequences introduced by the (GS4)6 linker. false Jennifer Lei BBa_K184001_sequence 1 gaagtgccgcctaaagaagagacccctgctgaagaaccaccgaaggaagaaacccctgctgaagagccgccaaaagaagaaaccccggctgaagaaccgccaaaggaagagactccggccgaagatccaccgaaagaagaggagaccccggccgaagagccgccgaaggacgaagcacctgccgctgctgagggtggtgaagagactaaagctgaagacggtggtggaggtagtggaggcggtggaagtgggggcggaggcagcggagggggaggctcagggggtggcggctctggaggaggtggtagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z