BBa_K1841003 1 BBa_K1841003 ribosome binding site for lactobacillus casei 2015-08-27T11:00:00Z 2015-09-07T08:34:15Z total synthesis by IDT ribosome binding site for lactobacillus casei false false _2267_ 28266 28266 9 false no false MIN YI YOU BBa_K1841002 1 BBa_K1841002 plac promoter for lactobacillus casei 2015-08-27T11:00:00Z 2015-09-07T08:36:03Z total synthesis by IDT The promoter region contains a cre element (catabolite responsive element) overlapping the ???35 region, which is followed by a highly conserved sequence, the ribonucleic antiterminator (RAT) sequence, and a terminator structure. This promoter can be positively regulated by lactose. false false _2267_ 28266 28266 9 false positively regulated by lactose false MIN YI YOU BBa_K1841004 1 BBa_K1841004 plac operon for lactobacillus casei 2015-08-27T11:00:00Z 2015-09-07T08:37:47Z total synthesis by IDT plac operon for lactobacillus casei false false _2267_ 28266 28266 9 false no false MIN YI YOU component2445723 1 BBa_K1841002 component2445724 1 BBa_K1841003 annotation2445723 1 BBa_K1841002 range2445723 1 1 150 annotation2445724 1 BBa_K1841003 range2445724 1 159 174 BBa_K1841003_sequence 1 ggaggtgatgacaact BBa_K1841004_sequence 1 gtttttataaaacgtttacattctgttcagatatggtacaacttgtttgttgataggaatattcaatgtggattgtgactatttaattaggcgagaccacaaatcgcagtgctgatcgcagcgcgtgatttgtggttttttctttgcacttactagagggaggtgatgacaact BBa_K1841002_sequence 1 gtttttataaaacgtttacattctgttcagatatggtacaacttgtttgttgataggaatattcaatgtggattgtgactatttaattaggcgagaccacaaatcgcagtgctgatcgcagcgcgtgatttgtggttttttctttgcact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z