BBa_K1843000 1 BBa_K1843000 Thrombin switch 1.0 2015-09-17T11:00:00Z 2015-09-18T04:42:39Z Synthesized based on published aptamer and GFP sequence Switch 1.0 (adapted for thrombin) with additional cut sites and a GFP reporter was submitted as a part. This part has been demonstrated as an RNA toehold switch, which responds to a specific DNA trigger and expresses GFP, with low background, as seen in Figure 1 of the results (LINK) section. This provides a starting point for other teams looking to adapt toehold switches. Additionally, the part submitted gives the many other teams inspired by the same publications, an easy control for in vitro translation reactions. Since it already contains a full switch and reporter, it can be transformed and purified and then used directly with a cell-free expression system, without any further cloning. The trigger is short enough to be quickly and cheaply bought as a DNA oligo. Thus, future teams exploring cell-free expression systems can test their systems induced with a DNA oligo (positive reaction control) and without (negative reaction control). false false _2269_ 17743 17743 9 false In order to ease the cloning process for future teams, an additional HindIII cut site was added between the switch and GFP. The HindIII cut site combined with the iGEM cut sites that surround the switch makes it easy to substitute the reporter. false Cristina Castillo annotation2474212 1 GFP range2474212 1 155 878 BBa_K1843000_sequence 1 tgccacctgacgtctaagaaatgcgaattctctagagcggccgcatcgtaatacgactcactatagggggttggtgtcacccattgtcttgctctatacagaaacagaggagatatagaatgagacaatggaacctggcggcagcgcaaaagcttcgtaaaatggtgagtaaaggtgaagaactgttcaccggtgttgttccgatcctggttgaactggatggtgatgttaacggccacaaattctctgttcgtggtgaaggtgaaggtgatgcaaccaacggtaaactgaccctgaaattcatctgcactaccggtaaactgccggttccatggccgactctggtgactaccctgacctatggtgttcagtgtttttctcgttacccggatcacatgaagcagcatgatttcttcaaatctgcaatgccggaaggttatgtacaggagcgcaccatttctttcaaagacgatggcacctacaaaacccgtgcagaggttaaatttgaaggtgatactctggtgaaccgtattgaactgaaaggcattgatttcaaagaggacggcaacatcctgggccacaaactggaatataacttcaactcccataacgtttacatcaccgcagacaaacagaagaacggtatcaaagctaacttcaaaattcgccataacgttgaagacggtagcgtacagctggcggaccactaccagcagaacactccgatcggtgatggtccggttctgctgccggataaccactacctgtccacccagtctaaactgtccaaagacccgaacgaaaagcgcgaccacatggtgctgctggagttcgttactgcagcaggtatcacgcacggcatggatgaactctacaaataataaaacagtcgagcccagcgtggttaaacactctagcataaccccttggggcctctaaacgggtcttgaggggttttttgatgcaccggtactagtctgcagattaccgcctttgagtgagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z