BBa_K1848001 1 BBa_K1848001 Human Gut Hormone Glucagon-like peptide 1 (7-37) (Sequence Lacks Stop Codon, but part possesses it) 2015-09-16T11:00:00Z 2015-09-18T03:54:39Z Human form of mature peptide Glp-1 Stimulates the secretion of insulin from the pancreas & increases the number of insulin-secreting beta cells in the pancreas. It decreases the secretion of glucagon, which stimulates glucose conversion from glycogen. Also increases satiety by slowing the emptying of the stomach. His-tagged version false false _2275_ 27274 27274 9 false To test for protein presence, peptide was his-tagged false Samuel Magaziner BBa_K1848001_sequence 1 atgcacgcggaaggcacttttacctctgacgtttcctcttatctggaaggccaggctgctaaagagttcatcgcgtggctggttaaaggccgtggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z