BBa_K1848002 1 BBa_K1848002 Human Gut Hormone Peptide YY (3-36) (Sequence Lacks Stop Codon, but part possesses it) 2015-09-17T11:00:00Z 2015-09-18T03:55:13Z Human genome, peptide YY hormone Natrually secreted in tandem with GLP-1 and works to decrease appetite & increase satiety. It is secreted after eating and works by binding to receptors in the brain. Also decreases digestion by slowing down movement of food through the digestive tract. It is secreted by L-cells in the small intestine. To be used in projects focusing on gut hormones, appetite, or peptide secreting microbiomes. false false _2275_ 27274 27274 9 false To screen for successful protein creation, a his-tag must be applied. false Samuel Magaziner BBa_K1848002_sequence 1 atgatcaaaccggaagcgccacgcgaagacgcgtctccggaagaactgaaccgttattacgcttccctgcgccactacctgaacctggtgacccgtcagcgttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z