BBa_K1848003 1 BBa_K1848003 Human Gut Hormone Ghrelin (28) (Sequence Lacks Stop Codon, but part possesses it) 2015-09-17T11:00:00Z 2015-09-18T03:55:46Z Human genome, Ghrelin Stimulates appetite to increases human food intake by up to 30% and promote fat storage by acting on the hypothalamus. Also has protective effects on the cardiovascular system and plays a role in regulating insulin levels. Mostly secreted by the stomach, but also the small intestine, pancreas, and brain. To be used in projects focusing on gut hormones, appetite, or peptide secreting microbiomes. false false _2275_ 27274 27274 9 false To test for protein presence, peptide was his-tagged false Samuel Magaziner BBa_K1848003_sequence 1 atgggttcctctttcctgtctcctgaacaccagcgtgttcagcagcgtaaggaatctaaaaagccgccagcaaaactacagccgcgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z