BBa_K185047 1 BBa_K185047 RelE toxin 2009-10-15T11:00:00Z 2015-05-08T01:11:07Z None None false false _318_ 0 3967 9 Not in stock false None false Alex Jiang annotation2046533 1 start range2046533 1 1 3 annotation2046574 1 stop range2046574 1 306 306 annotation2047133 1 His tag range2047133 1 286 303 annotation2047034 1 mutation range2047034 1 305 306 annotation2046560 1 cds range2046560 1 4 285 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_K185000 1 BBa_K185000 RelE toxin+Rbs30 2009-10-15T11:00:00Z 2015-05-08T01:11:06Z RelE gene comes from E.coli. RelE is a toxin gene. And this part is composite with BBa_B0030. false false _318_ 0 3967 9 It's complicated true None. false Alex Jiang component2218760 1 BBa_B0030 component2218758 1 BBa_K185047 annotation2218760 1 BBa_B0030 range2218760 1 315 329 annotation2218758 1 BBa_K185047 range2218758 1 1 306 BBa_B0030_sequence 1 attaaagaggagaaa BBa_K185047_sequence 1 atggcgtattttctggattttgacgagcgggcactaaaggaatggcgaaagctgggctcgacggtacgtgaacagttgaaaaagaagctggttgaagtacttgagtcaccccggattgaagcaaacaagctccgtggtatgcctgattgttacaagattaagctccggtcttcaggctatcgccttgtataccaggttatagacgagaaagttgtcgttttcgtgatttctgttgggaaaagagaacgctcggaagtatatagcgaggcggtcaaacgcattctccatcatcatcatcatcactaa BBa_K185000_sequence 1 atggcgtattttctggattttgacgagcgggcactaaaggaatggcgaaagctgggctcgacggtacgtgaacagttgaaaaagaagctggttgaagtacttgagtcaccccggattgaagcaaacaagctccgtggtatgcctgattgttacaagattaagctccggtcttcaggctatcgccttgtataccaggttatagacgagaaagttgtcgttttcgtgatttctgttgggaaaagagaacgctcggaagtatatagcgaggcggtcaaacgcattctccatcatcatcatcatcactaatactagagattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z