BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_K185047 1 BBa_K185047 RelE toxin 2009-10-15T11:00:00Z 2015-05-08T01:11:07Z None None false false _318_ 0 3967 9 Not in stock false None false Alex Jiang annotation2047034 1 mutation range2047034 1 305 306 annotation2047133 1 His tag range2047133 1 286 303 annotation2046533 1 start range2046533 1 1 3 annotation2046560 1 cds range2046560 1 4 285 annotation2046574 1 stop range2046574 1 306 306 BBa_K185004 1 BBa_K185004 RelE toxin+Double terminator 2009-10-15T11:00:00Z 2015-05-08T01:11:06Z It is to be edited It is to be edited false false _318_ 0 3967 9 It's complicated true It is to be edited false Alex Jiang component2048331 1 BBa_B0012 component2048329 1 BBa_B0010 component2048328 1 BBa_K185047 annotation2048328 1 BBa_K185047 range2048328 1 1 306 annotation2048329 1 BBa_B0010 range2048329 1 315 394 annotation2048331 1 BBa_B0012 range2048331 1 403 443 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K185004_sequence 1 atggcgtattttctggattttgacgagcgggcactaaaggaatggcgaaagctgggctcgacggtacgtgaacagttgaaaaagaagctggttgaagtacttgagtcaccccggattgaagcaaacaagctccgtggtatgcctgattgttacaagattaagctccggtcttcaggctatcgccttgtataccaggttatagacgagaaagttgtcgttttcgtgatttctgttgggaaaagagaacgctcggaagtatatagcgaggcggtcaaacgcattctccatcatcatcatcatcactaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K185047_sequence 1 atggcgtattttctggattttgacgagcgggcactaaaggaatggcgaaagctgggctcgacggtacgtgaacagttgaaaaagaagctggttgaagtacttgagtcaccccggattgaagcaaacaagctccgtggtatgcctgattgttacaagattaagctccggtcttcaggctatcgccttgtataccaggttatagacgagaaagttgtcgttttcgtgatttctgttgggaaaagagaacgctcggaagtatatagcgaggcggtcaaacgcattctccatcatcatcatcatcactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z