BBa_K1857002 1 BBa_K1857002 HSP70A-RBCS2_Hyg Expression Plasmid 2015-09-15T11:00:00Z 2015-09-18T03:13:45Z The parts were adapted from pOpt_mVenus_Hyg. This plasmid is designed to facilitate the easiest expression of proteins possible. It contains an HSP70A-RBCS2 fusion promoter attached to an RBCS2 intron, flanked by the iGEM prefix and suffix. There is an RBCS2 3' UTR after the suffix. Additionally, there is a complete Hygromycin B resistance cassette downstream, allowing for selection. The suffix can be removed and replaced with the coding sequence of a heterologous protein. Furthermore, the entire fusion-promoter-intron sequence can be removed with the prefix and suffix and replaced by an alternate promoter to compare expression levels between Chlamydomonas promoters. false false _2285_ 26495 26495 9 false We amplified the pHSP70A-RBCS2-Intron region with the iGEM prefix/suffix added to the ends. We then amplified 3'UTR RBCS2 with PstI upstream' and SpeI downstream. The hygromycin B resistance cassette was then amplified with XbaI upstream and SpeI downstream. pSB1C3 was amplified with primers which removed ligated with digested pHSP70A-RBCS2-Intron and pSB1C3 for final assembly. false Joshua Timmons annotation2473744 1 pRBCS2 range2473744 1 274 497 annotation2473743 1 pHSP70A range2473743 1 1 267 BBa_K1857002_sequence 1 gctgaggcttgacatgattggtgcgtatgtttgtatgaagctacaggactgatttggcgggctatgagggcgggggaagctctggaagggccgcgatggggcgcgcggcgtccagaaggcgccatacggcccgctggcggcacccatccggtataaaagcccgcgaccccgaacggtgacctccactttcagcgacaaacgagcacttatacatacgcgactattctgccgctatacataaccactcagctagcttaagatcccatcaccggtgcatgccgggcgcgccagaaggagcgcagccaaaccaggatgatgtttgatggggtatttgagcacttgcaacccttatccggaagccccctggcccacaaaggctaggcgccaatgcaagcagttcgcatgcagcccctggagcggtgccctcctgataaaccggccagggggcctatgttctttacttttttacaagagaagtcactcaacatcttaaaatggccaggtgagtcgacgagcaagcccggcggatcaggcagcgtgcttgcagatttgacttgcaacgcccgcattgtgtcgacgaaggcttttggctcctctgtcgctgtctcaagcagcatctaaccctgcgtcgccgtttccatttgcaggatgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z