BBa_K1859001 1 BBa_K1859001 the 3??side of the intron[BBa_K1332005] +GGSGGS linker 2015-09-06T11:00:00Z 2015-09-18T01:55:27Z T4 phage This part consists of mRNA circularization device (5?? side) and linker (amino acid sequence: GGSGGS). It???s the improved mRNA circularization parts (5?? side). The linker keeps a function of coded protein that is translated semi-permanently. The amino acids that consist of the linker is glycine and serine. Because their steric hindrance are small and their hydrophilicity are strong. The protein coding sequence that is inserted between this device and mRNA circularization device (3??? side) can be circularized. If you circularized the protein coding sequence (Its a stop codon have been removed.) with mRNA circularization device (3?? side) (endless translation)(BBa_K1332009), you can get a circular mRNA that is translated semi-permanently. false false _1707_2287_ 20591 21011 9 false We built a sequence of linker(GGSGGS) into the circuler mRNA. The linker keeps a function of coded protein that is translated semi-permanently. false Wataru Fukuda BBa_K1859001_sequence 1 ggttctacataaatgcctaacgactatccctttggggagtagggtcaagtgactcgaaacgatagacaacttgctttaacaagttggagatatagtctgctctgcatggtgacatgcagctggatataattccggggtaagattaacgaccttatctgaacataatgctaccgtttaatattgcgtcagggtggtagtggtggtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z