BBa_K1859005 1 BBa_K1859005 GSGSGS linker+ The 5??side of the intron [BBa_K1332003] 2015-09-06T11:00:00Z 2015-09-18T01:55:49Z T4 phage This part consists of mRNA circularization device (3?? side) (endless) and linker (amino acid sequence: GSGSGS). It???s the improved mRNA circularization parts (5?? side). The linker may keep a function of coded protein that is translated semi-permanently. The amino acids that consist of the linker is glycine and serine. Because their steric hindrance is small and their hydrophilicity are strong. The protein coding sequence that is inserted between this part and mRNA circularization device (5??? side)(BBa_K1332008) can be circularized. If you circularized the protein coding sequence (Its stop codon have been removed.), you can get a circular mRNA that is translated semi-permanently. false false _1707_2287_ 20591 21011 9 false We built a sequence of linker(HHHHHH) into the circuler mRNA. The linker may keep a function of coded protein that is translated semi-permanently. false Wataru Fukuda BBa_K1859005_sequence 1 gtagtggtagtggtagttcagagatgttttcttgggttaattgaggcctgagtataaggtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtaggact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z