BBa_K1859007 1 BBa_K1859007 the 3??side of the intron[BBa_K1332005] +GGSGGS*2 linker 2015-09-06T11:00:00Z 2015-09-18T02:27:18Z T4 phage This part consists of mRNA circularization device (5?? side) and linker (amino acid sequence: GGSGGSGGSGGS). It???s the improved mRNA circularization parts (5?? side). The linker may keep a function of coded protein that is translated semi-permanently. The amino acids that consist of the linker is glycine and serine. Because their steric hindrance are small and their hydrophilicity are strong. The protein coding sequence that is inserted between this device and mRNA circularization device (3??? side) can be circularized. If you circularized the protein coding sequence (Its a stop codon have been removed.) with mRNA circularization device (3?? side) (endless translation)(BBa_K1332009), you can get a circular mRNA that is translated semi-permanently. false false _2287_ 20591 26709 9 false We built a sequence of linker(GGSGGSGGSGGS) into the circuler mRNA. The linker may keep a function of coded protein that is translated semi-permanently. false Kairi ISHIMARU BBa_K1859007_sequence 1 ggttctacataaatgcctaacgactatccctttggggagtagggtcaagtgactcgaaacgatagacaacttgctttaacaagttggagatatagtctgctctgcatggtgacatgcagctggatataattccggggtaagattaacgaccttatctgaacataatgctaccgtttaatattgcgtcatactagaggtggtagtggtggtagtggtggtagtggtggtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z