BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961223 1 CAP binding site range1961223 1 89 126 BBa_K1332002 1 BBa_K1332002 Histidine tag (8 AA) and RFP (without stop codon) 2014-09-25T11:00:00Z 2015-09-17T07:54:33Z RFP is BBa_E1010. This part consists of histidine tag and RFP. His-tag is useful for purifying a long RFP. The RFP lacks its stop codon. false false _1707_ 20591 21011 9 It's complicated false Stop codons are removed to translate consecutively. false Kenta Nomura BBa_K1859007 1 BBa_K1859007 the 3??side of the intron[BBa_K1332005] +GGSGGS*2 linker 2015-09-06T11:00:00Z 2015-09-18T02:27:18Z T4 phage This part consists of mRNA circularization device (5?? side) and linker (amino acid sequence: GGSGGSGGSGGS). It???s the improved mRNA circularization parts (5?? side). The linker may keep a function of coded protein that is translated semi-permanently. The amino acids that consist of the linker is glycine and serine. Because their steric hindrance are small and their hydrophilicity are strong. The protein coding sequence that is inserted between this device and mRNA circularization device (3??? side) can be circularized. If you circularized the protein coding sequence (Its a stop codon have been removed.) with mRNA circularization device (3?? side) (endless translation)(BBa_K1332009), you can get a circular mRNA that is translated semi-permanently. false false _2287_ 20591 26709 9 false We built a sequence of linker(GGSGGSGGSGGS) into the circuler mRNA. The linker may keep a function of coded protein that is translated semi-permanently. false Kairi ISHIMARU BBa_K1859011 1 BBa_K1859011 2*GGSGGS linker+ the 5??side of the intron[BBa_K1332003] 2015-09-06T11:00:00Z 2015-09-18T02:30:13Z T4 phage This part consists of mRNA circularization device (3?? side) (endless) and linker (amino acid sequence: GGSGGSGGSGGS). It???s the improved mRNA circularization parts (5?? side). The linker may keep a function of coded protein that is translated semi-permanently. The amino acids that consist of the linker are histidine. Because it has some steric hindrance but its hydrophilicity is very strong. The protein coding sequence that is inserted between this part and mRNA circularization device (5??? side)(BBa_K1332008) can be circularized. If you circularized the protein coding sequence (Its stop codon have been removed.), you can get a circular mRNA that is translated semi-permanently. false false _2287_ 20591 26709 9 false We built a sequence of linker (GGSGGSGGSGGS) into the circuler mRNA. The linker may keep a function of coded protein that is translated semi-permanently. false Kairi ISHIMARU BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1859020 1 BBa_K1859020 Histidine tag and RFP linker [GGSGGS*2] semi-permanent generator 2015-09-08T11:00:00Z 2015-09-17T08:33:30Z T4 phage This device is all-in-one mRNA circularization device. If you transfer this device into E. coli, you can get a protein (its sequence is ???GGSGGSGGSGGS - amino acid derived from RBS sequence - HisRFP ??? GGSGGSGGSGGS - amino acid derived from ribozyme sequence ??? GGSGGSGGSGGS - amino acid derived from RBS sequence -???) false false _2287_ 20591 20590 9 false This part includes sequences which one of the linkers we designed(GGSGGSGGSGGS). false Yusuke Banno component2448313 1 BBa_R0010 component2448320 1 BBa_K1859007 component2448322 1 BBa_B0034 component2448323 1 BBa_K1332002 component2448331 1 BBa_B0015 component2448324 1 BBa_K1859011 annotation2448324 1 BBa_K1859011 range2448324 1 1178 1331 annotation2448313 1 BBa_R0010 range2448313 1 1 200 annotation2448331 1 BBa_B0015 range2448331 1 1340 1468 annotation2448323 1 BBa_K1332002 range2448323 1 467 1169 annotation2448322 1 BBa_B0034 range2448322 1 447 458 annotation2448320 1 BBa_K1859007 range2448320 1 209 438 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1859020_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagggttctacataaatgcctaacgactatccctttggggagtagggtcaagtgactcgaaacgatagacaacttgctttaacaagttggagatatagtctgctctgcatggtgacatgcagctggatataattccggggtaagattaacgaccttatctgaacataatgctaccgtttaatattgcgtcatactagaggtggtagtggtggtagtggtggtagtggtggtagtactagagaaagaggagaaatactagagagatgcatcatcatcatcatcatcatcatatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgctactagaggtggtagtggtggtagtggtggtagtggtggtagtactagagcagagatgttttcttgggttaattgaggcctgagtataaggtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtaggacttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1859011_sequence 1 gtggtagtggtggtagtggtggtagtggtggtagtactagagcagagatgttttcttgggttaattgaggcctgagtataaggtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtaggact BBa_K1332002_sequence 1 agatgcatcatcatcatcatcatcatcatatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_K1859007_sequence 1 ggttctacataaatgcctaacgactatccctttggggagtagggtcaagtgactcgaaacgatagacaacttgctttaacaagttggagatatagtctgctctgcatggtgacatgcagctggatataattccggggtaagattaacgaccttatctgaacataatgctaccgtttaatattgcgtcatactagaggtggtagtggtggtagtggtggtagtggtggtag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z