BBa_K1860700 1 BBa_K1860700 miRNA2911 2015-09-12T11:00:00Z 2015-09-13T09:11:06Z in progress: Enter the source of this part. For example, does it come from some genomic sequence? in progress: Enter a long description of the part so that users of your part know what it is, what it does, and how to use it in their projects. false false _2288_ 26797 26797 9 false in progress: Enter any design considerations you had to deal with during the detailed design of the sequence. false Maurice Langhinrichs, Vincent Fortuin, Henning Jacobsen annotation2453192 1 miRNA2911 range2453192 1 1 20 BBa_K1860702 1 BBa_K1860702 constitutive promoter and miRNA2911 2015-09-12T11:00:00Z 2015-09-13T09:45:50Z in progress: Enter the source of this part. For example, does it come from some genomic sequence? in progress: Enter a long description of the part so that users of your part know what it is, what it does, and how to use it in their projects. false false _2288_ 26797 26797 9 false in progress: Enter any design considerations you had to deal with during the detailed design of the sequence. false Maurice Langhinrichs, Vincent Fortuin, Henning Jacobsen component2453202 1 BBa_K1860700 component2453200 1 BBa_J23100 annotation2453200 1 BBa_J23100 range2453200 1 1 35 annotation2453202 1 BBa_K1860700 range2453202 1 44 63 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1860700_sequence 1 ggccgggggacggactggga BBa_K1860702_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagggccgggggacggactggga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z