BBa_K1860703 1 BBa_K1860703 GroEL promoter and blue pigment 2015-09-12T11:00:00Z 2015-09-13T09:53:45Z in progress: Enter the source of this part. For example, does it come from some genomic sequence? in progress: Enter a long description of the part so that users of your part know what it is, what it does, and how to use it in their projects. false false _2288_ 26797 26797 9 false in progress: Enter any design considerations you had to deal with during the detailed design of the sequence. false Maurice Langhinrichs, Vincent Fortuin, Henning Jacobsen component2453208 1 BBa_K592009 component2453206 1 BBa_K1860701 annotation2453208 1 BBa_K592009 range2453208 1 59 727 annotation2453206 1 BBa_K1860701 range2453206 1 1 52 BBa_K1860701 1 BBa_K1860701 GroEL promoter 2015-09-12T11:00:00Z 2015-09-13T09:25:58Z in progress: Enter the source of this part. For example, does it come from some genomic sequence? in progress: Enter a long description of the part so that users of your part know what it is, what it does, and how to use it in their projects. false false _2288_ 26797 26797 9 false in progress: Enter any design considerations you had to deal with during the detailed design of the sequence. false Maurice Langhinrichs, Vincent Fortuin, Henning Jacobsen annotation2453197 1 GroEL Promoter range2453197 1 1 52 annotation2453199 1 Ribosome Binding Site range2453199 1 41 47 annotation2453198 1 Pribnow Box range2453198 1 48 52 BBa_K592009 1 amilCP amilCP, blue chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:48Z Acropora millepora Released HQ 2013 This chromoprotein, amilCP, naturally exhibits very strong color when expressed. The color is blue/purple and is visible to naked eye, thereby requiring no instruments to observe. This DNA was provided by Jeffrey Miller at UCLA. It was made BioBrick-compatible after removal of one illegal internal restriction site (EcoRI). false false _763_ 0 7929 9 In stock true Illegal internal restriction site had to be removed (EcoRI). false Lei Sun annotation2131628 1 amilCP range2131628 1 1 666 BBa_K1860703_sequence 1 cagtttcccccttgaaggggcgaagcctcatccccatttgaaggagatattatactagatgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa BBa_K1860701_sequence 1 cagtttcccccttgaaggggcgaagcctcatccccatttgaaggagatatta BBa_K592009_sequence 1 atgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z