BBa_K1861102 1 BBa_K1861102 His-Tag 2015-09-17T11:00:00Z 2015-09-19T09:19:53Z Coming soon. Coming soon. false false _2291_ 25348 25348 9 false Coming soon. false Vladyslav Vyshnevskyi annotation2476068 1 BamHI restriction site range2476068 1 22 27 annotation2476066 1 ATG start codon range2476066 1 1 3 annotation2476067 1 6x His-Tag range2476067 1 4 21 BBa_K1861102_sequence 1 atgcatcaccaccatcatcacggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z