BBa_K1861103 1 BBa_K1861103 Spacer 2015-09-17T11:00:00Z 2015-09-18T06:17:34Z Coming soon. Coming soon. false false _2291_ 25348 25348 9 false Coming soon. false Vladyslav Vyshnevskyi annotation2476103 1 SacI restriction site range2476103 1 40 45 annotation2476102 1 TGA stop codon range2476102 1 46 48 BBa_K1861103_sequence 1 acgcacatttctataagtgcttcaccggcctgcgaacgcgagctctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z