BBa_K1865000 1 BBa_K1865000 BCEL_Dockerin 2015-09-14T11:00:00Z 2015-09-18T01:19:04Z The part was isolated from Bacertoides cellulolyticus DNA. This dockerin is derived from the organism Bacteroides cellulolyticus. The dockerin domain is a domain, which binds to a cohesin domain with the strength of half a covalent bond. In nature dockerins are found connecting enzymes to scaffoldin proteins, where they form multienzymatic complexes. This dockerin can be used in conjuction with an enzyme of choice, which can thereby be bound to a scaffoldin with a B. cellulolyticus cohesin or cohesin consensus sequence. false false _2295_ 27098 27115 9 Not in stock false When attaching any enzyme to the dockerin, please be verify whether the sequences of both enzyme and dockerin are in frame behind each other. false Avril von Hoyningen-Huene, Stefani Maria Diaz Valerio, Sindhu Thiagarajan, Verena Siebert BBa_K1865000_sequence 1 gaggactcatctatccaaaaggcacagctacagtattatatggtgacgttgataatgatggaaatgttgattcagacgactatgcatatatgagacaatggttgatcggtatgattgctgatttccctggaggagatatcggattagctaatgctgatgttgatggagacggaaatgtagattcagatgactatgcgtacatgagacaatggttaataggaatgatttccgagttcccagcagaacaaaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z