BBa_K1865001 1 BBa_K1865001 eforRed_BCEL 2015-09-16T11:00:00Z 2015-09-18T01:16:10Z BCEL was isolated from the DNA of Bacteroides cellulolyticus. eforRed was used from a gBlock with the BioBrick sequence of BBa_K592012. eforRed_BCEL consists of the dockerin BCEL (BBa_K1865000) and eforRed (BBa_K592012). By adding our dockerin to this BioBrick from the Uppsala 2011 team, we have made it compatible for use with our scaffoldin. The eforRed that will bind to the equivalent cohesin on a scaffoldin via the dockerin connected to it. The dockerin is derived from Bacteroides cellulolyticus and binds to the cohesin consensus sequence from this organism. eforRed was codon optimized for use in E.coli when used by Uppsala in 2011. It originally stems from eforRed_BCEL can used as a reporter for the detection of the scaffoldin construct in a sample. false false _2295_ 27098 27115 9 false The Composite BioBrick was assembled with alternative restriction sites into our expression vector pBAD. In this BioBrick the two sequences can be separated into their composite parts by using KpnI to cut in between the two. The outer restriction sites are EcoRI (prefix) and PstI (Suffix). false Avril von Hoyningen-Huene, Sindhu Thiagarajan, Verena Siebert component2465721 1 BBa_K1865000 component2465723 1 BBa_K592012 annotation2465723 1 BBa_K592012 range2465723 1 261 941 annotation2465721 1 BBa_K1865000 range2465721 1 1 254 BBa_K592012 1 eforRed eforRed, red chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:49Z coming soon This chromoprotein eforRed naturally exhibits red color when expressed. The color is weaker than RFP, however. On agar plates and in liquid culture, the color is readily visible to naked eye in less than 24 hours of incubation. The DNA was codon-optimized for expression in E.coli and synthesized by the Korean company Bioneer Corporation. false false _763_ 0 7929 9 It's complicated false coming soon false Lei Sun annotation2131799 1 eforRed range2131799 1 1 681 BBa_K1865000 1 BBa_K1865000 BCEL_Dockerin 2015-09-14T11:00:00Z 2015-09-18T01:19:04Z The part was isolated from Bacertoides cellulolyticus DNA. This dockerin is derived from the organism Bacteroides cellulolyticus. The dockerin domain is a domain, which binds to a cohesin domain with the strength of half a covalent bond. In nature dockerins are found connecting enzymes to scaffoldin proteins, where they form multienzymatic complexes. This dockerin can be used in conjuction with an enzyme of choice, which can thereby be bound to a scaffoldin with a B. cellulolyticus cohesin or cohesin consensus sequence. false false _2295_ 27098 27115 9 Not in stock false When attaching any enzyme to the dockerin, please be verify whether the sequences of both enzyme and dockerin are in frame behind each other. false Avril von Hoyningen-Huene, Stefani Maria Diaz Valerio, Sindhu Thiagarajan, Verena Siebert BBa_K592012_sequence 1 atgtcagtgattaagcaggtaatgaagaccaagttgcaccttgagggcactgtcaatggccatgattttacgatcgagggtaaaggtgaaggcaagccgtacgaagggttacagcacatgaaaatgacagtcaccaaaggcgcgcctctgccgttttccgttcatattcttacacctagccacatgtatggaagcaaaccgtttaataagtatccagcggatatcccagactaccacaaacagtcttttcccgaaggtatgtcttgggagcggtcgatgatttttgaagatggtggcgtatgcaccgccagtaatcactccagcataaacttgcaagagaactgtttcatctatgatgttaaatttcatggtgtgaacctgcctccggatgggcccgtaatgcaaaaaaccattgctggatgggagccgagcgtggaaacactgtacgtgcgtgacgggatgttaaaaagtgacactgcaatggtttttaaactgaaaggaggcggtcatcatcgtgttgatttcaaaacgacgtataaagccaaaaaacctgtcaagctgccagaatttcatttcgttgaacatcgcctggaactgaccaaacacgataaagatttcacaacttgggaccagcaggaggcagccgaaggccatttctcaccgctgccgaaggctctccca BBa_K1865000_sequence 1 gaggactcatctatccaaaaggcacagctacagtattatatggtgacgttgataatgatggaaatgttgattcagacgactatgcatatatgagacaatggttgatcggtatgattgctgatttccctggaggagatatcggattagctaatgctgatgttgatggagacggaaatgtagattcagatgactatgcgtacatgagacaatggttaataggaatgatttccgagttcccagcagaacaaaaataa BBa_K1865001_sequence 1 gaggactcatctatccaaaaggcacagctacagtattatatggtgacgttgataatgatggaaatgttgattcagacgactatgcatatatgagacaatggttgatcggtatgattgctgatttccctggaggagatatcggattagctaatgctgatgttgatggagacggaaatgtagattcagatgactatgcgtacatgagacaatggttaataggaatgatttccgagttcccagcagaacaaaaataatactagatgtcagtgattaagcaggtaatgaagaccaagttgcaccttgagggcactgtcaatggccatgattttacgatcgagggtaaaggtgaaggcaagccgtacgaagggttacagcacatgaaaatgacagtcaccaaaggcgcgcctctgccgttttccgttcatattcttacacctagccacatgtatggaagcaaaccgtttaataagtatccagcggatatcccagactaccacaaacagtcttttcccgaaggtatgtcttgggagcggtcgatgatttttgaagatggtggcgtatgcaccgccagtaatcactccagcataaacttgcaagagaactgtttcatctatgatgttaaatttcatggtgtgaacctgcctccggatgggcccgtaatgcaaaaaaccattgctggatgggagccgagcgtggaaacactgtacgtgcgtgacgggatgttaaaaagtgacactgcaatggtttttaaactgaaaggaggcggtcatcatcgtgttgatttcaaaacgacgtataaagccaaaaaacctgtcaagctgccagaatttcatttcgttgaacatcgcctggaactgaccaaacacgataaagatttcacaacttgggaccagcaggaggcagccgaaggccatttctcaccgctgccgaaggctctccca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z