BBa_K136006 1 BBa_K136006 flgA promoter followed by its natural RBS 2008-10-24T11:00:00Z 2015-05-08T01:10:02Z This part comes from the genome of E.coli K12 strain MG1655. Promoter of flgA gene from E. coli flagella flgA is a class 2 gene that is part of the construction of the flagella ( Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon ). Its promoter is consitutively repressed. It is activated by FlhD4C2 and maybe by FliA with different strength ( Using a Quantitative Blueprint to Reprogram the Dynamics of the Flagella Gene Network - Shiraz Kalir and Uri Alon ). false false _211_ 0 3262 9 It's complicated false >forward primer GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAGCATATCTCCTCCGCAGGTATCAAAAT >reverse primer GTTTCTTCCTGCAGCGGCCGCTACTAGTAACAGTATCGCGATGATCGCCACGCTACGT false Kok-Phen YAN annotation1986988 1 ATG range1986988 1 160 162 annotation1999347 1 nautral flgA RBS range1999347 1 146 154 annotation1986987 1 flhDC binding site range1986987 1 89 104 annotation1986986 1 flhDC binding site range1986986 1 63 78 annotation1986989 1 transcription initiation range1986989 1 138 138 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1866005 1 BBa_K1866005 Promoter+RibosomeBindingSite+NrfA (in pSB1C3) 2015-09-17T11:00:00Z 2015-09-18T05:25:42Z It was isolated from Escherichia coli K12 strain. The assimilatory Nitrite Reductase gene under the control of a strong Promoter Anderson J23104 with a Ribosome Binding Site was cloned onto the pSB1A3 plasmid backbone. This gene catalyses the conversion of Nitrite (NO2 -) to Ammonium (NH4 +). true false _2296_ 28697 28697 9 false No. The part is 3A compatible. false Stefan Oehler component2474235 1 BBa_K880005 component2474231 1 BBa_K136006 annotation2474231 1 BBa_K136006 range2474231 1 1 202 annotation2474235 1 BBa_K880005 range2474235 1 211 265 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K880005 1 BBa_K880005 Strong promoter, strong RBS combination for high expression levels of proteins 2012-09-28T11:00:00Z 2015-05-08T01:13:40Z It is a combination of strong promoter (J23100) and RBS (B0034). Released HQ 2013 -J23100+B0034 -Strong promoter, strong RBS combination for high expression levels of proteins Consensus constitutive promoter and RBS sequence-produces strongest possible expression. false false _1142_ 0 9403 9 In stock false Enter design considerations. false Josh Atkinson, Mike Ferguson, and Ben Parker component2204228 1 BBa_J23100 component2204230 1 BBa_B0034 annotation2204228 1 BBa_J23100 range2204228 1 1 35 annotation2204230 1 BBa_B0034 range2204230 1 44 55 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_K136006_sequence 1 agcatatctcctccgcaggtatcaaaattctgccatcagcttaaatgcctttacgcgcgcgttatcggcggaataaacgcaaaatgggtcgctatttatgccgttgatggtcattgcggacaggtacaattcacgttgtagaaatggctgggggcgaaaatgctgataataaaacgtagcgtggcgatcatcgcgatactgt BBa_K1866005_sequence 1 agcatatctcctccgcaggtatcaaaattctgccatcagcttaaatgcctttacgcgcgcgttatcggcggaataaacgcaaaatgggtcgctatttatgccgttgatggtcattgcggacaggtacaattcacgttgtagaaatggctgggggcgaaaatgctgataataaaacgtagcgtggcgatcatcgcgatactgttactagagttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaa BBa_K880005_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z