BBa_K1867000 1 BBa_K1867000 testing 2015-07-06T11:00:00Z 2015-07-07T03:27:21Z testing testing false false _2298_ 26805 26805 9 false testing false Quan Vuong component2432960 1 BBa_K112200 annotation2432960 1 BBa_K112200 range2432960 1 1 219 BBa_K112200 1 xis {xis!} from bacteriophage lambda; assembly standard 21 2008-10-19T11:00:00Z 2015-05-08T01:09:14Z pAH57 plasmid This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2048 9 It's complicated false ? false Molly Allen BBa_K1867000_sequence 1 atgtacttgacacttcaggagtggaacgcacgccagcgacgtccaagaagccttgaaacagttcgtcgatgggttcgggaatgcaggatattcccacctccggttaaggatggaagagagtatctgttccacgaatcagcggtaaaggttgacttaaatcgaccagtaacaggtggccttttgaagaggatcagaaatgggaagaaggcgaagtcatga BBa_K112200_sequence 1 atgtacttgacacttcaggagtggaacgcacgccagcgacgtccaagaagccttgaaacagttcgtcgatgggttcgggaatgcaggatattcccacctccggttaaggatggaagagagtatctgttccacgaatcagcggtaaaggttgacttaaatcgaccagtaacaggtggccttttgaagaggatcagaaatgggaagaaggcgaagtcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z