BBa_K187008 1 BBa_K187008 Sigma 70 100% promoter in pAB, BioBytes plasmid 2009-10-15T11:00:00Z 2015-05-08T01:11:07Z 100% promoter was modified from Anderson collection of promoters, part BBa_J23119. Plasmid pAB was derived from pUC19, and is entered as part BBa_K187000. The 100% promoter has a sigma 70 consensus sequence, and should produce maximal expression. The pAB plasmid (part BBa_K187000) adapts the promoter for assembly with other parts using the BioBytes assembly system. See the BioBytes BBF RFC for details on this method. false true _286_ 0 4048 9 Not in stock false The 100% promoter has a sigma 70 consensus sequence, and should produce maximal expression. The pAB plasmid adapts the promoter for assembly with other parts using the BioBytes assembly system. See the BioBytes RFC for details on this method. The Biobytes assembly method requires that the DNA fragments to be assembled have long sticky ends of particular sequence. DNA fragments with these sticky ends can be prepared using genes in pBA or pAB as a template. The structure of pAB and pBA will result in a ribosome binding site being included 7bp upstream of the start codon of the gene. It is not necessary to include a promoter with the gene when cloning it into pAB or pBA. Instead, a promoter with long sticky ends can be prepared from separate pAB and pBA plasmids just containing promoters. The desired promoter can then be assembled upstream of a gene using the BioBytes method. This abilty to easily 'mix and match' promoters and genes allows gene expresison to be standardized and optimized. Unlike standard cloning that would requires several days to insert a promoter into a plasmid upstream of a gene, the addition of one DNA segment with the BioBytes method takes only 20minutes. false Team BioBytes annotation2051650 1 PstI range2051650 1 47 52 annotation2051648 1 -35 range2051648 1 16 21 annotation2051647 1 XbaI range2051647 1 10 15 annotation2051649 1 -10 range2051649 1 40 45 BBa_K187008_sequence 1 tgaggaggttctagattgacagctaggtcagtgctaggtataatgcctgcagtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z