BBa_K187019 1 BBa_K187019 RFP in pAB, Biobytes plasmid 2009-10-16T11:00:00Z 2015-05-08T01:11:07Z Part BBa_J23018 was the source of RFP. Biobytes plasmid pAB is entered as BBa_K187000. RFP is a red fluoresent protein. The level of activity of a genetic system can be reported by the intensity of red fluorescence resulting from RFP expression. This RFP gene is present in plasmid pAB (part BBa_K187000), which is one of two universal plasmids for the BioBytes assembly method. For details of the BioBytes method, see its BBF RFC. false true _286_ 0 4048 9 It's complicated false This plasmid includes only the open reading frame (start codon to stop codon) of RFP. A promoter and terminator are not included. pAB and pBA do include an RBS consensus sequence positioned 8 bp upstream of the ATG. We recommend that to express RFP, you use the Biobytes assembly method together with the promoter and terminator parts we have submited in pAB and pBA to assemble promoters and terminators onto RFP. As there is a range of promoters to chose from, this allows rapid manipulation of gene expression level. Using the Biobytes method, several DNA segments can be combined in just 20min per segment. false Team Biobytes BBa_K187019_sequence 1 tgaggaggttctagaatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataactgcagtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z