BBa_K187023 1 BBa_K187023 GFP in pBA, BioBytes plasmid 2009-10-16T11:00:00Z 2015-05-08T01:11:07Z Part BBa_J61003 was the source of GFP. Biobytes plasmid pBA is entered as BBa_K187001. GFP is a green fluoresent protein. The level of activity of a genetic system can be reported by the intensity of green fluorescence resulting from GFP expression. This GFP gene is present in plasmid pBA (part BBa_K187001), which is one of two universal plasmids for the BioBytes assembly method. For details of the BioBytes method, see its BBF RFC. false true _286_ 0 4048 9 It's complicated false This plasmid includes only the open reading frame (start codon to stop codon) of GFP. A promoter and terminator are not included. pAB and pBA do include an RBS consensus sequence positioned 8 bp upstream of the ATG. We recommend that to express GFP, you use the Biobytes assembly method together with the promoter and terminator parts we have submited in pAB and pBA to assemble promoters and terminators onto GFP. As there is a range of promoters to chose from, this allows rapid manipulation of gene expression level. Using the Biobytes method, several DNA segments can be combined in just 20min per segment. false Team Biobytes BBa_K187023_sequence 1 tgaggaggttctagaatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataactgcagtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z