BBa_K187025 1 BBa_K187025 terminator in pAB, BioBytes plasmid 2009-10-17T11:00:00Z 2015-05-08T01:11:07Z The terminator is derived from part b1006. pAB is entered as part K187000. This part contains a bidirectional, high efficiency terminator, in the BioBytes universal plasmid pAB.See the BioBytes RFC for details on the BioBytes assembly method. false true _286_ 0 4048 9 It's complicated false A terminator with long sticky ends can be prepared from this plasmid and assembled downstream of a gene using the Biobytes method. The addition of one DNA segment with the BioBytes method takes only 20 minutes. This ability to easily 'mix and match' terminators and genes allows rapid testing of different terminator designs. false Julia Pon annotation2051724 1 XbaI range2051724 1 10 15 annotation2051725 1 PstI range2051725 1 53 58 BBa_K187025_sequence 1 tgaggaggtctagaaaaaaaaaccccgcccctgacagggcggggttttttttctgcagtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z