BBa_K187033 1 BBa_K187033 pAB/BA forward primer for sequencing 2009-10-18T11:00:00Z 2015-05-08T01:11:07Z oligo synthesis For sequencing inserts in pAB or pBA false false _286_ 0 4048 9 Not in stock true tm = 50.4, 40% GC, 20bp false Julia Pon BBa_K187033_sequence 1 catgagcggatacatatttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z