BBa_K187074 1 BBa_K187074 anchor forward strand B, Biobytes assembly method 2009-10-20T11:00:00Z 2015-05-08T01:11:08Z oligonucleotide synthesis A vital component of the BioBytes method is the use of a biotinylated DNA Anchor in order to allow unidirectional assembly of the Bytes on paramagnetic beads by sequestering the 5' ends of Bytes, leaving only the 3' ends available to bind incomding Bytes. This part can be annealed to the anchor reverse strand (BBa_K187422) to produce an anchor that has an B end. The end can be annealed to the B' end produced from a gene in plasmid pBA. The anchor itself has three vital components: A 5??? biotinylation, a double stranded DNA (dsDNA) portion that incorporates a release mechanism in order to liberate the construct from the beads, and A or B overhangs to allow Bytes to bind to the Anchor. The BioBytes anchor system utilizes a 5???-biotin which anchors the construct to beads by binding non-covalently, but with great strength, to the covalently linked streptavidin on the surface of the paramagnetic beads. There is also a 5???-15 nucleotide spacer region of ssDNA which facilitates more efficient binding of the Anchor to the bead as the binding pocket of streptavidin is deep and thus a highly flexible ssDNA linker is recommended to allow the biotin to effectively bind into this deep pocket. A 21 bp double stranded portion of the Anchor contains the I-SceI recognition sequence, which when digested with I-SceI produces 4 base overhangs, but also includes four deoxyuracil residues. These uracils are excised by New England Biolab???s USERTM system to generate single nucleotide gaps in the top strand. USERTM digestion thus effectively destroys the Anchor and produces a 21 base 3??? overhang which becomes important for recircularization of the construct. Finally the Anchor contains the A or B 3??? overhangs complementary to those of the Bytes, allowing their binding to the Anchor. false false _286_ 0 4048 9 Not in stock true See http://2009.igem.org/Team:Alberta/DNAanchor for binding capacity assays with the Biobytes anchor. We tested three alternative designs, which are documented on the wiki. The anchoring system we decided on, and submitted here, is small in size and the presence of the ssDNA spacer region gives this anchor a high binding capacity of about 200 pmol mg-1 beads. The presence of the dsDNA region allows Bytes to be ligated to the anchor and the incorporation of a deoxyuracil containing I-SceI site allows the construct to be released via the two methods described already(USER and I-SceI digestion). false Julia Pon annotation2061256 1 should be uracil not thymine range2061256 1 30 30 annotation2061255 1 should be uracil not thymine range2061255 1 20 20 annotation2061257 1 should be uracil not thymine range2061257 1 36 36 BBa_K187074_sequence 1 tctctctctctctctatattaaccagttatccctataatactacagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z