BBa_K187090 1 BBa_K187090 terminator forward strand B, Biobytes assembly method 2009-10-20T11:00:00Z 2015-05-08T01:11:08Z oligonucleotide synthesis This part can be annealed to the terminator reverse strand (BBa_K187077), to produce a B overhang, which can anneal to the B' end on the 3' end of a part produced from pAB. The biobytes assembly method can be used to rapidly assemble DNA segments in a particular order. The 3' end of constructs made with this method can be annealed to a terminator segment, which can be digested and annealed to the anchor to circularize the construct. For more details see http://2009.igem.org/Team:Alberta/DNAanchor, or RFC 47 false false _286_ 0 4048 9 Not in stock true Once the construct has been completed, i.e. the last Byte has been added, the construct may be released from the beads as is by a simple I-SceI digestion or a USERTM digestion, thus yielding a linear construct. If a circular construct, such as a plasmid, is desired then a final "Terminator" piece must be added. This piece is similar in construction to the Anchor, whereby there is a dsDNA I-SceI recognition sequence with four deoxyuracils incorporated into it on one strand, as well as an A or B 3' overhang. The Terminator binds to the last Byte and release is once again achieved by I-SceI digestion or USERTM digestion. In either case both the Anchor and Terminator develop sticky ends that are complementary to eachother: 4 bases if I-SceI digestion is utilized, or 21 bases if USER is used. USERTM digestion is obviously preferred since 21 bp of interaction will form spontaneously and without ligation, and thus transformation of the construct can proceed immediately. false Julia Pon annotation2061268 1 should be uracil not thymine range2061268 1 8 8 annotation2061270 1 should be uracil not thymine range2061270 1 21 21 annotation2061269 1 should be uracil not thymine range2061269 1 15 15 annotation2061267 1 should be uracil not thymine range2061267 1 2 2 BBa_K187090_sequence 1 atagggataacaggttaatatagctgtagtatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z