BBa_K187229 1 BBa_K187229 trxB ORF reverse primer 2009-10-18T11:00:00Z 2015-05-08T01:11:10Z Oligonucleotides were synthesized. Primers were tested using MG1655 E.coli genomic DNA as template BBa_K187229 false false _286_ 0 4048 9 Not in stock false This primer produced a product of the predicted size using the following reaction conditions: : Water: 17.05uL 10x pfu buffer: 2.5uL dNTPs (2mM): 2.5uL DMSO: 1.2uL MG1655 Genomic DNA: 0.5uL Forward primer (10uM): 0.5uL Reverse primer (10uM): 0.5uL Pfu polymerase: 0.25uL Total reaction volume: 25uL Thermocycling conditions: 95oC, 3min 95oC, 30s 56oC, 30s 72oC, 3min 29 cycles to step 2 72oC 2min All Biobytes essential gene primers were produced using Vector NTI. Each primer's thermodynamic properties were examined using Vector NTI's hairpin and dimerzation programs. Primers were optimized to fit as many of the following criteria as possible: ??? Find the shortest possible sequence, reducing the cost to produce the primer. ??? Produce the highest score value possible. ??? Produce the closest Tm's possible ??? Produce hairpins with dG values >-5 ??? Produce dimers with dG values >-10 The following are Vector NTI statistics for this primer: dG Dimer (kcal/mol): -2.3 dG Hairpin (kcal/mol): -0.7 false Julia Pon BBa_K187229_sequence 1 aagacacctctagaatgggcacgaccaaacacagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z