BBa_K187366 1 BBa_K187366 pAB_R (B end) USER primer for BioBytes plasmid pAB 2009-10-19T11:00:00Z 2015-05-08T01:11:12Z Oligonucleotide sequencing. This is the reverse primer of a pair of universal primers for amplifying any gene out of pAB (BBa_187000). These primers contain uracil deoxyribonucleotides, allowing for digestion with the USER system which can be purchased from New England Biolabs (NEB). This produces A and B overhangs and finishes the production of the Bytes. With the gene contained within the pAB and pBA plasmids, Bytes can be easily stored and amplified using the universal primers at any time. See the BioBytes RFC for details of the BioBytes assembly method. false false _286_ 0 4048 9 Not in stock true See the BioBytes RFC for details. false Team Biobytes annotation2057551 1 This should be uracil not thymine range2057551 1 6 6 annotation2057552 1 This should be uracil not thymine range2057552 1 12 12 BBa_K187366_sequence 1 agctgtagtattgcactgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z