BBa_K187417 1 BBa_K187417 trpA in pBA 2009-10-20T11:00:00Z 2015-05-08T01:11:12Z MG1655 E.coli genomic DNA trpA encodes the alpha subunit of tryptophan synthase, and is present in the standard biobrick vector pSB1A3. This gene is present in plasmid pBA (part BBa_K187001), which is one of two universal plasmids for the BioBytes assembly method. For details of the BioBytes method, see RFC 47. false true _286_ 0 4048 9 Not in stock false Note that the gene in this plasmid starts at the start codon and ends at the stop codon. pBA does not include a promoter or terminator. pBA does include an RBS consensus sequence positioned 8 bp upstream of the ATG. We recommend that to express this gene, you use the Biobytes assembly method together with the promoter and terminator parts we have submited in pAB and pBA to assemble promoters and terminators onto the gene. As there is a range of promoters to chose from, this allows rapid manipulation of gene expression level. Using the Biobytes method, several DNA segments can be combined in just 20min per segment. See RFC 47. false Julia Pon BBa_K187417_sequence 1 tgaggaggttctagaatggaacgctacgaatctctgtttgcccagttgaaggagcgcaaagaaggcgcattcgttcctttcgtcacgctcggtgatccgggcattgagcagtcattgaaaattatcgatacgctaattgaagccggtgctgacgcgctggagttaggtatccccttctccgacccactggcggatggcccgacgattcaaaacgccactctgcgcgcctttgcggcaggtgtgactccggcacaatgttttgaaatgctggcactgattcgccagaaacacccgaccattcccattggcctgttgatgtatgccaatctggtgtttaacaaaggcattgatgagttttatgcccagtgcgaaaaagtcggcgtcgattcggtgctggttgccgatgtgccagttgaagagtccgcgcccttccgccaggccgcgttgcgtcataatgtcgcacctatcttcatctgcccgccaaatgccgatgacgacctgctgcgccagatagcctcttacggtcgtggttacacctatttgctgtcacgagcaggcgtgaccggcgcagaaaaccgcgccgcgttacccctcaatcatctggttgcgaagctgaaagagtacaacgctgcacctccattgcagggatttggtatttccgccccggatcaggtaaaagcagcgattgatgcaggagctgcgggcgcgatttctggttcggccattgttaaaatcatcgagcaacatattaatgagccagagaaaatgctggcggcactgaaagtttttgtacaaccgatgaaagcggcgacgcgcagttaactgcagtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z