BBa_K187425 1 BBa_K187425 Origin in AB, Reverse primer 2009-10-20T11:00:00Z 2015-05-08T01:11:13Z Synthetic The pUC19 origin can be amplified from pAB or pBA using this primer in conjunction with the Origin AB forward primer. A high copy origin can be produced with A and B ends compatible with the BioBytes assembly method. Origins cannot be cloned into pAB and pBA using the standard BioBytes method because the presence of two origins will destabilize the plasmid. Some thymine bases in the above sequence must be replaced with uracil for correct function. Actual sequence is as follows: 5' AGCTGUAGTATUGCCGCGTTGCTGGCG 3' This part will allow amplification of a high copy origin to allow proliferation of an artificial BioBytes plasmid. See BBF RFC#47 for information on the BioBytes method. false false _286_ 0 4104 9 Not in stock true Primer was designed to give standard BioBytes B end. Uracil separation was experimentally optimized. false Mitch Paquette annotation2061303 1 should be uracil range2061303 1 12 12 annotation2061302 1 should be uracil range2061302 1 6 6 BBa_K187425_sequence 1 agctgtagtattgccgcgttgctggcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z