BBa_K187426 1 BBa_K187426 Origin in BA, Forward primer 2009-10-20T11:00:00Z 2015-05-08T01:11:13Z Synthetic The origin can be amplified from pMB1 using this primer in conjunction with the Origin BA reverse primer. A high copy origin can be produced with A and B ends compatible with the BioBytes assembly method. Origins cannot be cloned into pAB and pBA using the standard BioBytes method because the presence of two origins will destabilize the plasmid. Some thymine bases in the above sequence must be replaced with uracil for correct function. Actual sequence is as follows: 5' AATACUACAGCUGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGC 3' This part will allow amplification of a high copy origin to allow proliferation of an artificial BioBytes plasmid. See BBF RFC#47 for information on the BioBytes method. false false _286_ 0 4104 9 Not in stock true Primer was designed to give standrard BioBytes B end. Uracil spacing was experimentally optimized. false Mitch Paquette annotation2061343 1 should be uracil range2061343 1 12 12 annotation2061342 1 should be uracil range2061342 1 6 6 BBa_K187426_sequence 1 aatactacagctgatcaaaggatcttcttgagatcctttttttctgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z