BBa_K1875000 1 BBa_K1875000 This basic part contains a miniCMV promoter. 2016-10-10T11:00:00Z 2016-10-15T11:21:18Z This promoter was obtained from George Church and the Church Lab. The miniCMV promoter is the driving promoter for the following parts: BBa_K1875013, BBa_K1875014, BBa_K1875015, BBa_K1875016, BBa_K1875017, BBa_K1875018, BBa_K1875019. false false _2340_ 32298 32298 9 false Our lab did not design this sequence. false Jeffrey Marano BBa_K1875000_sequence 1 cgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctgga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z