BBa_K1875004 1 BBa_K1875004 A 20 bp target sequence and PAM to make guide operator 3 2016-10-10T11:00:00Z 2016-10-18T10:56:08Z This guide was synthesized by IDT This guide is produced by BBa_K1875011 used as the target site for BBa_K1875014 as well. false false _2340_ 32290 32298 9 false This guide was designed based on its orthogonality to the human genome (hg19) false Jeffrey Marano BBa_K1875004_sequence 1 aatgaacctattcgtaccgtggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z