BBa_K1875007 1 BBa_K1875007 A 20 bp target sequence and PAM to make guide operator 13 2016-10-10T11:00:00Z 2016-10-18T11:16:29Z This sequences was synthesized by IDT This part contains the target site for BBa_K1875016 false false _2340_ 32290 32298 9 false This sequenced was designed based on its orthogonality to the human genome (hg19) false Jeffrey Marano BBa_K1875007_sequence 1 gttctaaacgttggtccgtcggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z