BBa_K1875008 1 BBa_K1875008 Two repeated guide operators to make double operator 13 2016-10-10T11:00:00Z 2016-10-19T10:13:52Z This sequence was synthesized by IDT This part contains the target sequence for BBa_K1875017 false false _2340_ 32290 32298 9 false This part was designed by placing a random 24 base spacer between two g13 guides that make up BBa_K1875007 false Jeffrey Marano BBa_K1875008_sequence 1 gttctaaacgttggtccgtcgggtctattcgaactgcgcgaaagttcgttctaaacgttggtccgtcggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z