BBa_K1875009 1 BBa_K1875009 Three repeated guide operators to make triple operator 13 2016-10-10T11:00:00Z 2016-10-19T10:21:15Z This part was synthesized by IDT This part contains the target sequence for BBa_K1875018 false false _2340_ 32290 32298 9 false This part was designed by placing a random 24 base spacer between three g13 guides that make up BBa_K1875007 false Jeffrey Marano BBa_K1875009_sequence 1 gttctaaacgttggtccgtcgggtctattcgaactgcgcgaaagttcgttctaaacgttggtccgtcgggtctattcgaactgcgcgaaagttcgttctaaacgttggtccgtcggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z