BBa_K1875010 1 BBa_K1875010 Base 10 target mutation to make mutated guide operator 13 2016-10-10T11:00:00Z 2016-10-19T11:05:16Z This part was synthesized by IDT This part contains the target sequence for BBa_K1875019 false false _2340_ 32290 32298 9 false The 10th base of BBa_K1875007 was mutated from a G to a T false Jeffrey Marano BBa_K1875010_sequence 1 gttctaaactttggtccgtcggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z