BBa_K1875011 1 BBa_K1875011 This part produces a guide RNA that pairs with an operator. 2016-10-10T11:00:00Z 2016-10-15T11:43:08Z This plasmid was based off of the work by Feng Zhanf at MIT and the x330 plasmid. Guide RNA g3 Expression Part This composite part can be used to express a guide RNA (g3) from BostonU 2016???s project Gemini. Specifically, this part expresses g3, a guide RNA that directly recognizes the 20bp target sequence 5??? AATGAACCTATTCGTACCGT 3???. This 20bp target sequence can be found in composite part BBa_K1875003. We used transient transfection into HEK293FT cells to validate functionality of this part. We co-delivered a plasmid with BBa_K1875000 (this composite part with g3), a plasmid with BBa_K1875003 (the corresponding GFP reporter composite part with g3???s target sequence), and a plasmid expressing dCas9-VPR. We assayed for fluorescence of GFP using flow cytometry. We compared expression levels of GFP both with and without the guide RNA. Our results indicate that there is a low level of expression without g3 and a high level of expression with g3. false false _2340_ 32298 32298 9 false This part produces the guide in BBa_K1875011 and the guide that matches the target sequence on BBa_K1875014 false Jeffrey Marano BBa_K1875011_sequence 1 gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgaatgaacctattcgtaccgtgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z