BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1877051 1 BBa_K1877051 Constitutive promoter+RBS+lysis protein+stop 2016-09-20T11:00:00Z 2016-10-04T09:17:25Z iDT and registry This is an additional part of the construct if we successfully ligate the colicin true false _2342_ 26326 26326 9 false We have to monitor the metabolic stress of the host cell before putting this part into the construct false Ruijie Tang component2485915 1 BBa_B0034 component2485917 1 BBa_B0010 component2485916 1 BBa_K117000 component2485913 1 BBa_J23102 annotation2485915 1 BBa_B0034 range2485915 1 44 55 annotation2485917 1 BBa_B0010 range2485917 1 214 293 annotation2485913 1 BBa_J23102 range2485913 1 1 35 annotation2485916 1 BBa_K117000 range2485916 1 62 205 BBa_J23102 1 BBa_J23102 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters Released HQ 2013 replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K117000 1 BBa_K117000 Lysis gene (promotes lysis in colicin-producing bacteria strain) 2008-10-06T11:00:00Z 2015-05-08T01:09:34Z to be updated Released HQ 2013 This lysis gene encodes for the lysis protein in colicin-producing strains of bacteria. Once activated, it causes the host cell to lyze. It also removes the immunity protein out of colicin, and hence, activates the endonuclease activity of the colicin. false false _209_ 0 2774 9 In stock true to be updated true Nguyen Xuan Hung BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1877051_sequence 1 ttgacagctagctcagtcctaggtactgtgctagctactagagaaagaggagaaatactagatgaaaaaaataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagggcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_J23102_sequence 1 ttgacagctagctcagtcctaggtactgtgctagc BBa_K117000_sequence 1 atgaaaaaaataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagggcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z